ID: 1047377647_1047377651

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1047377647 1047377651
Species Human (GRCh38) Human (GRCh38)
Location 8:124317800-124317822 8:124317827-124317849
Sequence CCTTTCTCCCTTGCTGGCTCTGA GCAGGCTGCCATGTTGTGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 13, 3: 48, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!