ID: 1047401296_1047401306

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1047401296 1047401306
Species Human (GRCh38) Human (GRCh38)
Location 8:124549817-124549839 8:124549855-124549877
Sequence CCCTGCCCGAAAGGAAGGTGATT GGTATATTGTGACCAGACCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 92} {0: 2, 1: 1, 2: 0, 3: 6, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!