ID: 1047401298_1047401306

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1047401298 1047401306
Species Human (GRCh38) Human (GRCh38)
Location 8:124549822-124549844 8:124549855-124549877
Sequence CCCGAAAGGAAGGTGATTTGCCC GGTATATTGTGACCAGACCCCGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 26, 4: 202} {0: 2, 1: 1, 2: 0, 3: 6, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!