ID: 1047448507_1047448510

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1047448507 1047448510
Species Human (GRCh38) Human (GRCh38)
Location 8:124941446-124941468 8:124941467-124941489
Sequence CCATCCTCATTTTACAGGTGAAG AGGATCTAAAACCTGAAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 35, 3: 248, 4: 817} {0: 1, 1: 0, 2: 3, 3: 23, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!