ID: 1047457922_1047457927

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1047457922 1047457927
Species Human (GRCh38) Human (GRCh38)
Location 8:125033062-125033084 8:125033099-125033121
Sequence CCTGGCTCTACACTAAAGATTTC GACCCTGACCTCTGCCTGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 34, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!