ID: 1047461531_1047461535

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1047461531 1047461535
Species Human (GRCh38) Human (GRCh38)
Location 8:125070246-125070268 8:125070293-125070315
Sequence CCATGACTGAAATTCCACAAAAG TGTGTGACTCACAATCAGATAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!