ID: 1047521349_1047521353

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1047521349 1047521353
Species Human (GRCh38) Human (GRCh38)
Location 8:125597575-125597597 8:125597594-125597616
Sequence CCAAGTGACTAAGTTCTATATGA ATGAAGATATAGGCTGGGTGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!