ID: 1047595600_1047595608

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1047595600 1047595608
Species Human (GRCh38) Human (GRCh38)
Location 8:126374838-126374860 8:126374880-126374902
Sequence CCTCCGGTCTCTAGATAACAGCT GTTTATTTACAAAAGATGGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!