ID: 1047614847_1047614855

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1047614847 1047614855
Species Human (GRCh38) Human (GRCh38)
Location 8:126555944-126555966 8:126555986-126556008
Sequence CCCAGCCTCCTGGATCCCATACA CAGACAAGCAGCTTTCGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 191} {0: 1, 1: 0, 2: 0, 3: 9, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!