ID: 1047722106_1047722111

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1047722106 1047722111
Species Human (GRCh38) Human (GRCh38)
Location 8:127650583-127650605 8:127650618-127650640
Sequence CCTGGGCATACTGGCAAGATCCC AAAAATTACAAAAATTAGCTGGG
Strand - +
Off-target summary No data {0: 244, 1: 9996, 2: 89739, 3: 183673, 4: 200822}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!