ID: 1047722109_1047722112

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1047722109 1047722112
Species Human (GRCh38) Human (GRCh38)
Location 8:127650605-127650627 8:127650623-127650645
Sequence CCATCTCTACAAAAAAAATTACA TTACAAAAATTAGCTGGGCATGG
Strand - +
Off-target summary {0: 8, 1: 265, 2: 2616, 3: 9132, 4: 50438} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!