ID: 1047739991_1047739995

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1047739991 1047739995
Species Human (GRCh38) Human (GRCh38)
Location 8:127798606-127798628 8:127798624-127798646
Sequence CCCAGCACTTTGGGAGGCTGAGG TGAGGCCGGTAGATTACCTGAGG
Strand - +
Off-target summary {0: 90349, 1: 212695, 2: 235979, 3: 260133, 4: 296590} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!