ID: 1047757806_1047757820

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1047757806 1047757820
Species Human (GRCh38) Human (GRCh38)
Location 8:127932018-127932040 8:127932071-127932093
Sequence CCATCCTCAGGCTTCCTCTGTTG ATGGAGGGCCTGGCCTTTGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 24, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!