ID: 1047773325_1047773335

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1047773325 1047773335
Species Human (GRCh38) Human (GRCh38)
Location 8:128048576-128048598 8:128048612-128048634
Sequence CCCCAGAAGCTGGGATCAGCTTC GAGTCAGACCTGCTGGGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 207} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!