ID: 1047773330_1047773341

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1047773330 1047773341
Species Human (GRCh38) Human (GRCh38)
Location 8:128048599-128048621 8:128048648-128048670
Sequence CCCATCTGATGGTGAGTCAGACC CATGGCTGCCTGTGTGACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 65} {0: 1, 1: 1, 2: 4, 3: 111, 4: 729}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!