ID: 1047773331_1047773338

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1047773331 1047773338
Species Human (GRCh38) Human (GRCh38)
Location 8:128048600-128048622 8:128048630-128048652
Sequence CCATCTGATGGTGAGTCAGACCT TTTGGGTCCTCGCTCCAGCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 125} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!