ID: 1047779501_1047779510

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1047779501 1047779510
Species Human (GRCh38) Human (GRCh38)
Location 8:128099961-128099983 8:128099996-128100018
Sequence CCAGCCAGCCGCAGGGTGGGTTT ATGGCTGTATGGGGTGGAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 50, 4: 494}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!