ID: 1047855783_1047855792

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1047855783 1047855792
Species Human (GRCh38) Human (GRCh38)
Location 8:128910117-128910139 8:128910166-128910188
Sequence CCTGTAGGACACCTTCAAGGAGA GAAGGGTAACAGAGGGTAAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!