ID: 1048026430_1048026433

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1048026430 1048026433
Species Human (GRCh38) Human (GRCh38)
Location 8:130591484-130591506 8:130591531-130591553
Sequence CCTGGCACAGACCATGCATGTAG CTGAGTGCATTGTAGATTCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!