ID: 1048026996_1048027003

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1048026996 1048027003
Species Human (GRCh38) Human (GRCh38)
Location 8:130596264-130596286 8:130596313-130596335
Sequence CCATTGCGGGGGCCCTCTGCCAT GCCCTTCTGCCAGCAGCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 89} {0: 1, 1: 0, 2: 5, 3: 40, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!