ID: 1048051882_1048051890

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1048051882 1048051890
Species Human (GRCh38) Human (GRCh38)
Location 8:130825941-130825963 8:130825992-130826014
Sequence CCTGGAGGACTACTTCCGCAGGA ACAAAGTTGGAGACCTCCTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!