ID: 1048080537_1048080546

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1048080537 1048080546
Species Human (GRCh38) Human (GRCh38)
Location 8:131121837-131121859 8:131121884-131121906
Sequence CCCACTTTCCTCTGGGGAAACTT CAGAGGCAGAAGGGAGATGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 96, 4: 934}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!