ID: 1048084613_1048084617

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1048084613 1048084617
Species Human (GRCh38) Human (GRCh38)
Location 8:131163120-131163142 8:131163150-131163172
Sequence CCTGAGTCTCATTTCTTAGGCTT ACTTTGGTTTAGAACTTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!