ID: 1048096461_1048096464

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1048096461 1048096464
Species Human (GRCh38) Human (GRCh38)
Location 8:131300595-131300617 8:131300611-131300633
Sequence CCAGGCTTAATACCACATGGAAG ATGGAAGCTGCCAAGGCTTATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 11, 3: 37, 4: 113} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!