ID: 1048151421_1048151432

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1048151421 1048151432
Species Human (GRCh38) Human (GRCh38)
Location 8:131898993-131899015 8:131899040-131899062
Sequence CCCTCCTTAGGATCCACCACAGT ATGTACCGCAAGAAGCACTAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!