ID: 1048175614_1048175625

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1048175614 1048175625
Species Human (GRCh38) Human (GRCh38)
Location 8:132149660-132149682 8:132149688-132149710
Sequence CCACACCCACCCCAAGGGCCACA GCGCGCGGGACAGTTGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 78, 4: 593} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!