ID: 1048199739_1048199743

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1048199739 1048199743
Species Human (GRCh38) Human (GRCh38)
Location 8:132362399-132362421 8:132362445-132362467
Sequence CCACATTGCCAAGTCATTTGCAA CAGTTCCAGCAGAAACTGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 20, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!