ID: 1048214083_1048214091

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1048214083 1048214091
Species Human (GRCh38) Human (GRCh38)
Location 8:132480304-132480326 8:132480329-132480351
Sequence CCTCGTCGCGGCCGCCGCCCTCC CAGCAGGGTCCCGTCTTTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 74, 4: 512} {0: 1, 1: 1, 2: 0, 3: 5, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!