ID: 1048247047_1048247053

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1048247047 1048247053
Species Human (GRCh38) Human (GRCh38)
Location 8:132816960-132816982 8:132817001-132817023
Sequence CCACCTTACCCATGCCTGATGAT TCTCCCTCTCCAGCCACTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 137} {0: 1, 1: 0, 2: 3, 3: 44, 4: 364}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!