ID: 1048252306_1048252314

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1048252306 1048252314
Species Human (GRCh38) Human (GRCh38)
Location 8:132876927-132876949 8:132876947-132876969
Sequence CCTTAGCCACCCATGCTACCCAG CAGATTGCCCAGTGGGAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 22, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!