ID: 1048299191_1048299196

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1048299191 1048299196
Species Human (GRCh38) Human (GRCh38)
Location 8:133238987-133239009 8:133239009-133239031
Sequence CCCTCGCTGGTGTGGGAGCGGCT TTCGGGTGCCCTCGCTGGTGTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 7, 4: 104} {0: 1, 1: 1, 2: 0, 3: 10, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!