ID: 1048300059_1048300074

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1048300059 1048300074
Species Human (GRCh38) Human (GRCh38)
Location 8:133244946-133244968 8:133244984-133245006
Sequence CCAGCCTGGAAATGGGCAGCGCT GGGGGAGGCTGCGGGGAGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 15, 3: 357, 4: 2924}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!