ID: 1048356345_1048356349

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1048356345 1048356349
Species Human (GRCh38) Human (GRCh38)
Location 8:133657031-133657053 8:133657058-133657080
Sequence CCACATAGTCACAGGTTCTGATG ATTAGGACATATACATCTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 29, 3: 191, 4: 734}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!