ID: 1048378561_1048378570

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1048378561 1048378570
Species Human (GRCh38) Human (GRCh38)
Location 8:133844340-133844362 8:133844380-133844402
Sequence CCAGGAAACAGTCTCTAAGGTGG ATTTATTAAGGGGTGTCATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 203} {0: 1, 1: 0, 2: 0, 3: 19, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!