ID: 1048426979_1048426989

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1048426979 1048426989
Species Human (GRCh38) Human (GRCh38)
Location 8:134332154-134332176 8:134332205-134332227
Sequence CCACCCACTTTCCACTGCCAAAG TATTCAGGAGAGGAAGTGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 32, 4: 359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!