ID: 1048553966_1048553981

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1048553966 1048553981
Species Human (GRCh38) Human (GRCh38)
Location 8:135457597-135457619 8:135457626-135457648
Sequence CCGCCCGCGCCCGCTCCTCCTCG GCCCGGAGCGCGGGGGCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 62, 4: 688} {0: 1, 1: 0, 2: 7, 3: 78, 4: 499}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!