ID: 1048553982_1048553988

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1048553982 1048553988
Species Human (GRCh38) Human (GRCh38)
Location 8:135457627-135457649 8:135457643-135457665
Sequence CCCGGAGCGCGGGGGCCGCCGGC CGCCGGCGCTGGGTACTCGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 39, 4: 393} {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!