ID: 1048558361_1048558364

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1048558361 1048558364
Species Human (GRCh38) Human (GRCh38)
Location 8:135505370-135505392 8:135505390-135505412
Sequence CCTGCTTGTGGTCCCTTGGGACC ACCCTTGAGAGCTCTCCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 103} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!