ID: 1048624541_1048624542

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1048624541 1048624542
Species Human (GRCh38) Human (GRCh38)
Location 8:136170866-136170888 8:136170887-136170909
Sequence CCATTTAGTAACACAACACAATC TCTTAATTACTGCAGCTATATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 57, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!