ID: 1048700376_1048700381

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1048700376 1048700381
Species Human (GRCh38) Human (GRCh38)
Location 8:137082017-137082039 8:137082038-137082060
Sequence CCTTGCATCCCCTGGTAACCAGA GACAACCACCTATCTGCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 276} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!