ID: 1048707769_1048707779

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1048707769 1048707779
Species Human (GRCh38) Human (GRCh38)
Location 8:137173295-137173317 8:137173344-137173366
Sequence CCCTTTTCCATATGTGTCTCCAG CATGGGAGCCTTCAAAATGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 11, 3: 26, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!