ID: 1048825044_1048825051

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1048825044 1048825051
Species Human (GRCh38) Human (GRCh38)
Location 8:138416140-138416162 8:138416179-138416201
Sequence CCCTTGATCCCCCAGGACAAAAT TACTTTTGGAGTACAAAACTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!