ID: 1048872847_1048872851

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1048872847 1048872851
Species Human (GRCh38) Human (GRCh38)
Location 8:138813121-138813143 8:138813145-138813167
Sequence CCTCTTTGGGGTCTTCCTGAGTC ACCCCAGGATACCCCTATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 224} {0: 1, 1: 0, 2: 0, 3: 5, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!