ID: 1048950788_1048950798

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1048950788 1048950798
Species Human (GRCh38) Human (GRCh38)
Location 8:139495327-139495349 8:139495365-139495387
Sequence CCTCCAGCCTGCTCAGCAAGGTG CCTCAGCCTGGAAAACCAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 59, 4: 457} {0: 1, 1: 0, 2: 10, 3: 69, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!