ID: 1048952204_1048952211

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1048952204 1048952211
Species Human (GRCh38) Human (GRCh38)
Location 8:139505435-139505457 8:139505477-139505499
Sequence CCAAGCTGGTTCTGGTGTGGTTT TCCTATAGCCATACTGGGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!