ID: 1049010441_1049010451

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1049010441 1049010451
Species Human (GRCh38) Human (GRCh38)
Location 8:139883817-139883839 8:139883870-139883892
Sequence CCGGCTCTGCTCACTCTGGAGCC GTCTCCCTGTTTGTAAATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 55, 4: 374} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!