ID: 1049167661_1049167663

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1049167661 1049167663
Species Human (GRCh38) Human (GRCh38)
Location 8:141136714-141136736 8:141136727-141136749
Sequence CCAGAGCGCCAGAGCCTGAGGAT GCCTGAGGATGTCGCCGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 178} {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!