ID: 1049190941_1049190945

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1049190941 1049190945
Species Human (GRCh38) Human (GRCh38)
Location 8:141287032-141287054 8:141287058-141287080
Sequence CCGTGTGACCTTGAGGAAGTCGC ACCGCTCCAGGTCATGTGCGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 31, 3: 163, 4: 680} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!