ID: 1049203322_1049203341

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1049203322 1049203341
Species Human (GRCh38) Human (GRCh38)
Location 8:141352135-141352157 8:141352185-141352207
Sequence CCTGGCCCACAGCTTTCTGGTGG ACCCTGGAGTCAGGCAGGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 13, 3: 93, 4: 624}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!