ID: 1049206876_1049206888

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1049206876 1049206888
Species Human (GRCh38) Human (GRCh38)
Location 8:141367626-141367648 8:141367676-141367698
Sequence CCATCCAGGAGACAGTGGCTGGC AGGGGGAAACTGAGGCACGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 338} {0: 2, 1: 12, 2: 110, 3: 513, 4: 1623}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!